Primer Design and Phylogenetic Analysis of Nemalion elminthoides

Introduction

This GitHub post documents a bioinformatics workflow for algal species identification and phylogenetic analysis using the red alga Nemalion elminthoides as the target organism. The workflow included sequence retrieval from NCBI, multiple sequence alignment, primer design using Primer3, primer verification using Primer-BLAST, and phylogenetic tree construction using MEGA.

The selected barcode gene was rbcL, which is commonly used for algal species identification and phylogenetic reconstruction.

---

Objectives

The objectives of this workflow were:

1. To retrieve rbcL sequences of Nemalion elminthoides and related red algal species from NCBI.
2. To align the sequences using ClustalW in MEGA.
3. To design primers for amplification of a region of the rbcL gene.
4. To verify the primer pair using Primer-BLAST.
5. To construct a phylogenetic tree using MEGA.
6. To interpret the relationship between Nemalion elminthoides and related red algal taxa.

---

Target Organism and Gene

Target organism: Nemalion elminthoides
Gene: rbcL
Database: NCBI Nucleotide
Analysis tools: NCBI, Primer3, Primer-BLAST, MEGA

---

Sequence Retrieval from NCBI

The NCBI Nucleotide database was used to retrieve rbcL sequences. The target sequence was Nemalion elminthoides KP238497.1. Additional rbcL sequences from related red algal taxa were downloaded for comparison and phylogenetic analysis.

Species	Gene	Accession number	Sequence type	Database
Nemalion elminthoides	rbcL	KP238497.1	partial cds; chloroplast	NCBI Nucleotide
Actinotrichia robusta	rbcL	KC609400.1	partial cds; plastid	NCBI Nucleotide
Actinotrichia fragilis	rbcL	KC609399.1	partial cds; plastid	NCBI Nucleotide
Actinotrichia robusta	rbcL	KC609393.1	partial cds; plastid	NCBI Nucleotide
Liagora ceranoides	rbcL	JX878367.1	partial cds; chloroplast	NCBI Nucleotide

Screenshot to add:

---

Multiple Sequence Alignment

The five rbcL sequences were imported into MEGA and aligned using ClustalW. The alignment was used for phylogenetic tree construction and to evaluate sequence similarity among the selected taxa.

Alignment settings:

Parameter	Setting
Software	MEGA
Alignment method	ClustalW
Sequence type	DNA
Number of taxa	5
Gene	rbcL

Screenshot to add:

---

Primer Design

Primer design was performed using the clean rbcL sequence of Nemalion elminthoides KP238497.1. Because the shared alignment region among all five taxa was limited, primer design was performed using the target organism sequence directly. The selected primers were then checked using Primer-BLAST.

Primer3 selected the following primer pair:

Primer	Sequence 5′→3′	Strand	Length	Start	Stop	Tm	GC%	Product length
Forward primer	GACATGCGCTTACCTGTAGC	Plus	20	337	356	59.07°C	55.00%	230 bp
Reverse primer	CGCATGAACGGTTGAGAGTT	Minus	20	566	547	58.85°C	50.00%	230 bp

The selected primer pair amplifies a predicted 230 bp region of the rbcL gene. Both primers were 20 bp long, had similar melting temperatures, and had suitable GC contents.

Screenshot to add:

---

Primer-BLAST Verification

The primer pair was checked using NCBI Primer-BLAST. The expected PCR product length was 230 bp. Primer-BLAST confirmed the primer pair positions on the target rbcL sequence.

Primer-BLAST summary:

Parameter	Result
Forward primer	GACATGCGCTTACCTGTAGC
Reverse primer	CGCATGAACGGTTGAGAGTT
Forward primer position	337–356
Reverse primer position	566–547
Product length	230 bp
Target gene	rbcL
Target organism	Nemalion elminthoides

Screenshot to add:

---

Phylogenetic Tree Construction

The aligned rbcL sequences were used to construct a phylogenetic tree in MEGA. The tree was generated using the Neighbor-Joining method. Bootstrap analysis was performed with 1000 replications.

The original course protocol recommended the Kimura 2-parameter model. However, in this dataset, MEGA could not compute the Kimura 2-parameter distance matrix for all sequence pairs. Therefore, the final tree was reconstructed using the p-distance model.

Tree construction parameters:

Parameter	Setting
Software	MEGA
Tree method	Neighbor-Joining
Test of phylogeny	Bootstrap method
Bootstrap replications	1000
Substitution model	p-distance
Rates among sites	Uniform rates
Gaps/missing data treatment	Pairwise deletion

---

Phylogenetic Tree Result

The phylogenetic tree separated the selected red algal taxa into two main supported groups. Nemalion elminthoides clustered with Liagora ceranoides with a bootstrap value of 100, indicating strong support for this relationship. Actinotrichia fragilis clustered with one Actinotrichia robusta sequence, also with a bootstrap value of 100. The second Actinotrichia robusta sequence appeared as a separate branch.

These results suggest that Nemalion elminthoides is more closely related to Liagora ceranoides than to the selected Actinotrichia sequences in this rbcL-based analysis.

---

Conclusion

This workflow demonstrated a complete bioinformatics approach for algal species identification and phylogenetic analysis. The rbcL gene sequence of Nemalion elminthoides was used to design primers with Primer3, and the resulting primer pair was verified using Primer-BLAST. The primer pair produced a predicted 230 bp amplicon with suitable melting temperature and GC content.

A phylogenetic tree was constructed using MEGA based on five rbcL sequences. The tree showed that Nemalion elminthoides clustered strongly with Liagora ceranoides, while the Actinotrichia sequences formed a separate group. Overall, this analysis supports the usefulness of the rbcL gene for primer design and phylogenetic reconstruction in red algae.